gdpP [2019-04-22 18:25:03]

c-di-AMP specific phosphodiesterase

Locus: BSU40510

Isoelectric point: 4.86

Molecular weight: 74.14 kDa

Protein length: 659 aa

Gene length: 1980 bp

Function: control of sporulation initiation, cell wall homeostasis

Product: c-di-AMP phosphodiesterase

Essential: no

Synonyms: yybT

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Nucleotide metabolism → Metabolism of signalling nucleotides
• Information processing → Targets of second messengers → Targets of (p)ppGpp
• Groups of genes → Membrane proteins

Gene

Coordinates: 4,163,643 4,165,622

Phenotypes of a mutant

• inactivation of gdpP strongly restores beta-lactam resistance in a sigM mutant PubMed
• a gdpP pgpH double mutant acquires suppressor mutations in cdaA PubMed
• a gdpP pgpH double mutant is defective in biofilm formation PubMed
• altered morphology on MSgg medium PubMed

The protein

Catalyzed reaction/ biological activity

• cyclic dinucleotide phosphodiesterase, hydrolysis of cyclic di-AMP PubMed

Domains

• two transmembrane domains at the N-terminus PubMed
• a domain that shares minimum sequence homology with Heme-binding [PAS domain|Per-ARNT-Sim (PAS) domains] (80 aa) PubMed
• degenerate GGDEF domain (aa 173 - 301) PubMed
• a DHH-DHHA1 domain PubMed

Effectors of protein activity

• ppGpp inhibits cyclic dinucleotide phosphodiesterase activity PubMed
• Heme binding suppresses phosphodiesterase activity PubMed

Structure

• 2M1C (N-terminal PAS domain of GdpP from Geobacillus thermodenitrificans) PubMed

Expression and Regulation

Operons

• Genes: yybS-gdpP-rplI
  Description: PubMed

  Additional information

  • term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of yybS PubMed

Biological materials

Mutant

• MGNA-B834 (yybT::erm), available at the NBRP B. subtilis, Japan
• GP998 (gdpP::spc), available in Jörg Stülke's lab PubMed
• GP2040 (gdpP::spc pgpH::erm without terminator, available in Jörg Stülke's lab) PubMed
• BKE40510 (gdpP::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTCTATCACTCCCCACC, downstream forward: _UP4_AGATGAAGGTTATTTTCTTA
• BKK40510 (gdpP::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTCTATCACTCCCCACC, downstream forward: _UP4_AGATGAAGGTTATTTTCTTA

References

Reviews

Loading

Original publications

Loading

GdpP homologs in other organisms

Loading